Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2486923..2487148 | Replicon | chromosome |
| Accession | NZ_CP124900 | ||
| Organism | Enterococcus faecalis strain EfsC108 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ58_RS11855 | Protein ID | WP_021164442.1 |
| Coordinates | 2487047..2487148 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2486923..2487110 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ58_RS11830 | 2482543..2483496 | - | 954 | WP_085443718.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ58_RS11830 | 2482543..2483496 | - | 954 | WP_085443718.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ58_RS11835 | 2483535..2484290 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ58_RS11835 | 2483535..2484290 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ58_RS11840 | 2484287..2485252 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ58_RS11840 | 2484287..2485252 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ58_RS11845 | 2485249..2486196 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ58_RS11845 | 2485249..2486196 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ58_RS11850 | 2486381..2486833 | + | 453 | WP_282897119.1 | YueI family protein | - |
| QLQ58_RS11850 | 2486381..2486833 | + | 453 | WP_282897119.1 | YueI family protein | - |
| - | 2486923..2487110 | + | 188 | - | - | Antitoxin |
| QLQ58_RS11855 | 2487047..2487148 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| QLQ58_RS11855 | 2487047..2487148 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| QLQ58_RS11860 | 2487339..2489609 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ58_RS11860 | 2487339..2489609 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ58_RS11865 | 2489780..2490280 | + | 501 | WP_153853912.1 | cysteine hydrolase family protein | - |
| QLQ58_RS11865 | 2489780..2490280 | + | 501 | WP_153853912.1 | cysteine hydrolase family protein | - |
| QLQ58_RS11870 | 2490886..2491782 | + | 897 | WP_002365354.1 | YitT family protein | - |
| QLQ58_RS11870 | 2490886..2491782 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T281597 WP_021164442.1 NZ_CP124900:c2487148-2487047 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 188 bp
>AT281597 NZ_CP124900:2486923-2487110 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAACGCAACAAGGGTTGCA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAACGCAACAAGGGTTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|