Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 477093..477327 | Replicon | chromosome |
| Accession | NZ_CP124900 | ||
| Organism | Enterococcus faecalis strain EfsC108 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | C7CXQ5 |
| Locus tag | QLQ58_RS02345 | Protein ID | WP_002355568.1 |
| Coordinates | 477093..477209 (+) | Length | 39 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 477192..477327 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ58_RS02335 | 472531..474789 | + | 2259 | WP_282897229.1 | DNA helicase PcrA | - |
| QLQ58_RS02340 | 474915..476945 | + | 2031 | WP_282897230.1 | NAD-dependent DNA ligase LigA | - |
| QLQ58_RS02345 | 477093..477209 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
| - | 477192..477327 | - | 136 | - | - | Antitoxin |
| QLQ58_RS02350 | 477527..477832 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
| QLQ58_RS02355 | 477832..479301 | + | 1470 | WP_002368026.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
| QLQ58_RS02360 | 479301..480731 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
| QLQ58_RS02365 | 480750..481838 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T281595 WP_002355568.1 NZ_CP124900:477093-477209 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 136 bp
>AT281595 NZ_CP124900:c477327-477192 [Enterococcus faecalis]
TGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTGGTGGCTTACTGAGTTATTGG
TTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
TGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTGGTGGCTTACTGAGTTATTGG
TTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|