Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2655205..2655465 | Replicon | chromosome |
| Accession | NZ_CP124894 | ||
| Organism | Enterococcus faecalis strain EfsC116 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ63_RS13030 | Protein ID | WP_075551663.1 |
| Coordinates | 2655364..2655465 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2655205..2655415 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ63_RS13005 (2650889) | 2650889..2651842 | - | 954 | WP_002394760.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ63_RS13010 (2651881) | 2651881..2652636 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ63_RS13015 (2652633) | 2652633..2653598 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ63_RS13020 (2653595) | 2653595..2654542 | - | 948 | WP_002359058.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ63_RS13025 (2654727) | 2654727..2655179 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - (2655205) | 2655205..2655415 | + | 211 | NuclAT_4 | - | Antitoxin |
| - (2655242) | 2655242..2655419 | + | 178 | NuclAT_12 | - | - |
| QLQ63_RS13030 (2655364) | 2655364..2655465 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| QLQ63_RS13035 (2655654) | 2655654..2657924 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ63_RS13040 (2658095) | 2658095..2658595 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
| QLQ63_RS13045 (2658898) | 2658898..2659794 | + | 897 | WP_002354953.1 | YitT family protein | - |
| QLQ63_RS13050 (2659845) | 2659845..2660243 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281549 WP_075551663.1 NZ_CP124894:c2655465-2655364 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT281549 NZ_CP124894:2655205-2655415 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|