Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2597774..2598035 | Replicon | chromosome |
| Accession | NZ_CP124893 | ||
| Organism | Enterococcus faecalis strain EfsC123 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ42_RS12470 | Protein ID | WP_224561205.1 |
| Coordinates | 2597934..2598035 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2597774..2597985 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ42_RS12445 | 2593458..2594411 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ42_RS12450 | 2594450..2595205 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ42_RS12455 | 2595202..2596167 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ42_RS12460 | 2596164..2597111 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ42_RS12465 | 2597296..2597748 | + | 453 | WP_002378807.1 | YueI family protein | - |
| - | 2597774..2597985 | + | 212 | - | - | Antitoxin |
| QLQ42_RS12470 | 2597934..2598035 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
| QLQ42_RS12475 | 2598226..2600496 | - | 2271 | WP_002378809.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ42_RS12480 | 2600667..2601173 | + | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
| QLQ42_RS12485 | 2601363..2602259 | + | 897 | WP_002365354.1 | YitT family protein | - |
| QLQ42_RS12490 | 2602310..2602708 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T281537 WP_224561205.1 NZ_CP124893:c2598035-2597934 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 212 bp
>AT281537 NZ_CP124893:2597774-2597985 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|