Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 579808..580040 | Replicon | chromosome |
Accession | NZ_CP124891 | ||
Organism | Enterococcus faecalis strain EfsC130 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | QLQ45_RS02915 | Protein ID | WP_002355568.1 |
Coordinates | 579808..579924 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 579835..580040 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ45_RS02905 (575246) | 575246..577504 | + | 2259 | WP_002364805.1 | DNA helicase PcrA | - |
QLQ45_RS02910 (577630) | 577630..579660 | + | 2031 | WP_002364804.1 | NAD-dependent DNA ligase LigA | - |
QLQ45_RS02915 (579808) | 579808..579924 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- (579835) | 579835..580040 | - | 206 | NuclAT_4 | - | Antitoxin |
QLQ45_RS02920 (580242) | 580242..580547 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
QLQ45_RS02925 (580547) | 580547..582016 | + | 1470 | WP_002358701.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
QLQ45_RS02930 (582016) | 582016..583446 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
QLQ45_RS02935 (583465) | 583465..584553 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T281519 WP_002355568.1 NZ_CP124891:579808-579924 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT281519 NZ_CP124891:c580040-579835 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|