Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2601185..2601663 | Replicon | chromosome |
| Accession | NZ_CP124887 | ||
| Organism | Enterococcus faecalis strain EfsPNK7 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ46_RS12425 | Protein ID | WP_162780856.1 |
| Coordinates | 2601185..2601286 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2601462..2601663 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ46_RS12400 | 2596680..2597633 | - | 954 | WP_010713727.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ46_RS12405 | 2597672..2598427 | - | 756 | WP_282859008.1 | ATP-binding cassette domain-containing protein | - |
| QLQ46_RS12410 | 2598424..2599389 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ46_RS12415 | 2599386..2600333 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ46_RS12420 | 2600518..2600970 | + | 453 | WP_010707017.1 | YueI family protein | - |
| QLQ46_RS12425 | 2601185..2601286 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
| - | 2601462..2601663 | + | 202 | - | - | Antitoxin |
| QLQ46_RS12430 | 2601617..2601718 | - | 102 | WP_224800345.1 | putative holin-like toxin | - |
| QLQ46_RS12435 | 2601907..2604177 | - | 2271 | WP_010713724.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ46_RS12440 | 2604348..2604848 | + | 501 | WP_002408270.1 | cysteine hydrolase family protein | - |
| QLQ46_RS12445 | 2605549..2606445 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T281467 WP_162780856.1 NZ_CP124887:c2601286-2601185 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 202 bp
>AT281467 NZ_CP124887:2601462-2601663 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|