Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2586024..2586249 | Replicon | chromosome |
| Accession | NZ_CP124886 | ||
| Organism | Enterococcus faecalis strain EfsPF13 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ55_RS12650 | Protein ID | WP_075551663.1 |
| Coordinates | 2586148..2586249 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2586024..2586203 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ55_RS12620 | 2581240..2582193 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ55_RS12625 | 2582232..2582987 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ55_RS12630 | 2582984..2583949 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ55_RS12635 | 2583946..2584893 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ55_RS12640 | 2585078..2585530 | + | 453 | WP_002354958.1 | YueI family protein | - |
| QLQ55_RS12645 | 2585715..2585816 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| - | 2586024..2586203 | + | 180 | - | - | Antitoxin |
| QLQ55_RS12650 | 2586148..2586249 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| QLQ55_RS12655 | 2586439..2588709 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ55_RS12660 | 2588880..2589380 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
| QLQ55_RS12665 | 2589927..2590823 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281441 WP_075551663.1 NZ_CP124886:c2586249-2586148 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT281441 NZ_CP124886:2586024-2586203 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|