Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2628592..2628815 | Replicon | chromosome |
Accession | NZ_CP124884 | ||
Organism | Enterococcus faecalis strain EfsPF15 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QLQ47_RS12605 | Protein ID | WP_075551663.1 |
Coordinates | 2628714..2628815 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2628592..2628769 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ47_RS12580 (2624239) | 2624239..2625192 | - | 954 | WP_002394760.1 | siderophore ABC transporter substrate-binding protein | - |
QLQ47_RS12585 (2625231) | 2625231..2625986 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QLQ47_RS12590 (2625983) | 2625983..2626948 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ47_RS12595 (2626945) | 2626945..2627892 | - | 948 | WP_002359058.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ47_RS12600 (2628077) | 2628077..2628529 | + | 453 | WP_002359057.1 | YueI family protein | - |
- (2628555) | 2628555..2628765 | + | 211 | NuclAT_6 | - | - |
- (2628592) | 2628592..2628769 | + | 178 | NuclAT_5 | - | Antitoxin |
QLQ47_RS12605 (2628714) | 2628714..2628815 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
- (2628989) | 2628989..2629198 | + | 210 | NuclAT_7 | - | - |
- (2629023) | 2629023..2629202 | + | 180 | NuclAT_4 | - | - |
QLQ47_RS12610 (2629147) | 2629147..2629248 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
QLQ47_RS12615 (2629438) | 2629438..2631708 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QLQ47_RS12620 (2631879) | 2631879..2632379 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
QLQ47_RS12625 (2632682) | 2632682..2633578 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281412 WP_075551663.1 NZ_CP124884:c2628815-2628714 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 178 bp
>AT281412 NZ_CP124884:2628592-2628769 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|