Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2691623..2691846 | Replicon | chromosome |
Accession | NZ_CP124882 | ||
Organism | Enterococcus faecalis strain EfsPF20 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QLQ60_RS13115 | Protein ID | WP_075551663.1 |
Coordinates | 2691745..2691846 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2691623..2691800 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ60_RS13090 | 2687270..2688223 | - | 954 | WP_002365350.1 | siderophore ABC transporter substrate-binding protein | - |
QLQ60_RS13095 | 2688262..2689017 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QLQ60_RS13100 | 2689014..2689979 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ60_RS13105 | 2689976..2690923 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ60_RS13110 | 2691108..2691560 | + | 453 | WP_002354958.1 | YueI family protein | - |
- | 2691623..2691800 | + | 178 | - | - | Antitoxin |
QLQ60_RS13115 | 2691745..2691846 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
QLQ60_RS13120 | 2692178..2692279 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
QLQ60_RS13125 | 2692469..2694739 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QLQ60_RS13130 | 2694910..2695410 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
QLQ60_RS13135 | 2695809..2696705 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281391 WP_075551663.1 NZ_CP124882:c2691846-2691745 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 178 bp
>AT281391 NZ_CP124882:2691623-2691800 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|