Detailed information of TA system TA278587

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 52803..53228
• Replicon: plasmid pEC0430-1
• Accession: NZ_CP123047
• Organism: Escherichia coli strain EC0430

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QDU34_RS23430
• Protein ID: WP_223195199.1
• Coordinates: 53106..53228 (+)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	52803..53014 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QDU34_RS23400 (48146)	48146..48967	-	822	WP_001272931.1	abortive infection system antitoxin AbiGi family protein	-
QDU34_RS23405 (49337)	49337..49570	+	234	WP_001209608.1	DUF905 domain-containing protein	-
QDU34_RS23410 (49629)	49629..51587	+	1959	Protein_41	ParB/RepB/Spo0J family partition protein	-
QDU34_RS23415 (51642)	51642..52076	+	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
QDU34_RS23420 (52073)	52073..52792	+	720	WP_001276275.1	plasmid SOS inhibition protein A	-
- (52803)	52803..53014	+	212	NuclAT_0	-	Antitoxin
- (52803)	52803..53014	+	212	NuclAT_0	-	Antitoxin
- (52803)	52803..53014	+	212	NuclAT_0	-	Antitoxin
- (52803)	52803..53014	+	212	NuclAT_0	-	Antitoxin
QDU34_RS23425 (53048)	53048..53161	+	114	Protein_44	DUF5431 family protein	-
QDU34_RS23430 (53106)	53106..53228	+	123	WP_223195199.1	Hok/Gef family protein	Toxin
QDU34_RS23435 (53529)	53529..53850	-	322	Protein_46	hypothetical protein	-
QDU34_RS23440 (53852)	53852..54139	+	288	WP_000107544.1	hypothetical protein	-
QDU34_RS23445 (54257)	54257..55078	+	822	WP_001234469.1	DUF932 domain-containing protein	-
QDU34_RS23450 (55375)	55375..56022	-	648	WP_001825185.1	transglycosylase SLT domain-containing protein	-
QDU34_RS23455 (56299)	56299..56682	+	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
QDU34_RS23460 (56873)	56873..57559	+	687	WP_001825184.1	PAS domain-containing protein	-
QDU34_RS23465 (57653)	57653..57880	+	228	WP_001254386.1	conjugal transfer relaxosome protein TraY	-
QDU34_RS23470 (57914)	57914..58003	+	90	Protein_53	type IV conjugative transfer system pilin TraA	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iucA / iucB / iucC / iucD / iutA / vat / iroN / iroE / iroD / iroC / iroB	1..207503	207503
	-	flank	IS/Tn	-	-	58018..59226	1208

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T278587 WP_223195199.1 NZ_CP123047:53106-53228 [Escherichia coli]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT278587 NZ_CP123047:52803-53014 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin