Detailed information of TA system TA278040

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-agrB/-
• Location: 16188..16612
• Replicon: plasmid unnamed5
• Accession: NZ_CP122842
• Organism: Escherichia coli strain ETEC1729

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QDW97_RS26120
• Protein ID: WP_223163518.1
• Coordinates: 16490..16612 (+)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	agrB
Locus tag	-
Coordinates	16188..16405 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QDW97_RS26080 (11382)	11382..11879	+	498	WP_053528525.1	single-stranded DNA-binding protein	-
QDW97_RS26085 (11937)	11937..12170	+	234	WP_000006001.1	DUF905 family protein	-
QDW97_RS26090 (12236)	12236..14194	+	1959	WP_282843804.1	ParB/RepB/Spo0J family partition protein	-
QDW97_RS26095 (14249)	14249..14683	+	435	WP_042634413.1	conjugation system SOS inhibitor PsiB	-
QDW97_RS26100 (14680)	14680..15087	+	408	Protein_15	plasmid SOS inhibition protein A	-
QDW97_RS26105 (15143)	15143..15840	+	698	WP_094096600.1	IS1-like element IS1A family transposase	-
QDW97_RS26110 (15856)	15856..16243	+	388	Protein_17	plasmid SOS inhibition protein A	-
- (16188)	16188..16405	+	218	NuclAT_0	-	Antitoxin
- (16188)	16188..16405	+	218	NuclAT_0	-	Antitoxin
- (16188)	16188..16405	+	218	NuclAT_0	-	Antitoxin
- (16188)	16188..16405	+	218	NuclAT_0	-	Antitoxin
QDW97_RS26115 (16393)	16393..16545	+	153	Protein_18	DUF5431 family protein	-
QDW97_RS26120 (16490)	16490..16612	+	123	WP_223163518.1	Hok/Gef family protein	Toxin
QDW97_RS26125 (16994)	16994..17644	+	651	WP_000993956.1	IS66-like element accessory protein TnpA	-
QDW97_RS26130 (17644)	17644..17991	+	348	WP_000624618.1	IS66 family insertion sequence element accessory protein TnpB	-
QDW97_RS26135 (18011)	18011..19582	+	1572	WP_000381442.1	IS66 family transposase	-
QDW97_RS26140 (19625)	19625..19921	-	297	Protein_23	hypothetical protein	-
QDW97_RS26145 (20145)	20145..20441	+	297	WP_001272240.1	hypothetical protein	-
QDW97_RS26150 (20547)	20547..21368	+	822	WP_001234469.1	DUF932 domain-containing protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	-	hlyD / hlyB / hlyA / hlyC	1..120023	120023
	-	inside	IScluster/Tn	-	-	5280..19582	14302

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4506.32 Da
• Isoelectric Point: 8.2691

>T278040 WP_223163518.1 NZ_CP122842:16490-16612 [Escherichia coli]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESGGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 218 bp

>AT278040 NZ_CP122842:16188-16405 [Escherichia coli]
TCACACGGATTTCCCGTGAACTGGCTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGTATATG
GGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTATCCTGTCGTGTGGCAGAAGGA
CAAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCTCTGCATGTCTAGTCCAC

Structures

Antitoxin