Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 482413..482645 | Replicon | chromosome |
Accession | NZ_CP121233 | ||
Organism | Enterococcus faecalis strain SVJ-EF01 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | ORD27_RS02405 | Protein ID | WP_002355568.1 |
Coordinates | 482413..482529 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 482440..482645 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ORD27_RS02395 (477851) | 477851..480109 | + | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
ORD27_RS02400 (480235) | 480235..482265 | + | 2031 | WP_010828568.1 | NAD-dependent DNA ligase LigA | - |
ORD27_RS02405 (482413) | 482413..482529 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- (482440) | 482440..482645 | - | 206 | NuclAT_2 | - | Antitoxin |
ORD27_RS02410 (482847) | 482847..483152 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
ORD27_RS02415 (483152) | 483152..484621 | + | 1470 | WP_002368026.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
ORD27_RS02420 (484621) | 484621..486051 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
ORD27_RS02425 (486070) | 486070..487158 | + | 1089 | WP_002383001.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T276108 WP_002355568.1 NZ_CP121233:482413-482529 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT276108 NZ_CP121233:c482645-482440 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATGC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATGC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|