Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 935785..936011 | Replicon | chromosome |
| Accession | NZ_CP121204 | ||
| Organism | Staphylococcus aureus strain SA0907 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | A0A0E0VS87 |
| Locus tag | P7F77_RS04595 | Protein ID | WP_000253688.1 |
| Coordinates | 935785..935892 (+) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF2 | ||
| Locus tag | - | ||
| Coordinates | 935945..936011 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P7F77_RS04575 (931046) | 931046..934726 | + | 3681 | WP_278043736.1 | phage tail spike protein | - |
| P7F77_RS04580 (934713) | 934713..934865 | + | 153 | WP_001181555.1 | hypothetical protein | - |
| P7F77_RS04585 (934912) | 934912..935199 | + | 288 | WP_001040257.1 | hypothetical protein | - |
| P7F77_RS04590 (935257) | 935257..935553 | + | 297 | WP_000539688.1 | DUF2951 domain-containing protein | - |
| P7F77_RS04595 (935785) | 935785..935892 | + | 108 | WP_000253688.1 | putative holin-like toxin | Toxin |
| - (935945) | 935945..936011 | - | 67 | NuclAT_1 | - | Antitoxin |
| - (935945) | 935945..936011 | - | 67 | NuclAT_1 | - | Antitoxin |
| - (935945) | 935945..936011 | - | 67 | NuclAT_1 | - | Antitoxin |
| - (935945) | 935945..936011 | - | 67 | NuclAT_1 | - | Antitoxin |
| P7F77_RS04600 (935936) | 935936..936040 | - | 105 | Protein_895 | hypothetical protein | - |
| P7F77_RS04605 (936091) | 936091..936393 | + | 303 | WP_000387656.1 | phage holin | - |
| P7F77_RS04610 (936405) | 936405..937859 | + | 1455 | WP_103067904.1 | N-acetylmuramoyl-L-alanine amidase | - |
| P7F77_RS04615 (938852) | 938852..939409 | + | 558 | WP_000528632.1 | PBECR4 domain-containing protein | - |
| P7F77_RS04620 (939884) | 939884..940023 | + | 140 | Protein_899 | hypothetical protein | - |
| P7F77_RS04625 (940029) | 940029..940343 | - | 315 | WP_031875045.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | hlb | 877115..941748 | 64633 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3817.78 Da Isoelectric Point: 10.4997
>T276063 WP_000253688.1 NZ_CP121204:935785-935892 [Staphylococcus aureus]
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
Download Length: 108 bp
Antitoxin
Download Length: 67 bp
>AT276063 NZ_CP121204:c936011-935945 [Staphylococcus aureus]
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
