Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-RNAII/- |
| Location | 2896171..2896430 | Replicon | chromosome |
| Accession | NZ_CP119528 | ||
| Organism | Enterococcus faecalis strain 3143 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | P0083_RS14505 | Protein ID | WP_021164442.1 |
| Coordinates | 2896329..2896430 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | RNAII | ||
| Locus tag | - | ||
| Coordinates | 2896171..2896375 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P0083_RS14475 | 2891423..2892376 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| P0083_RS14480 | 2892415..2893170 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| P0083_RS14485 | 2893167..2894132 | - | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| P0083_RS14490 | 2894129..2895076 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| P0083_RS14495 | 2895261..2895713 | + | 453 | WP_002378959.1 | YueI family protein | - |
| P0083_RS14500 | 2895895..2895996 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - | 2896171..2896375 | + | 205 | - | - | Antitoxin |
| P0083_RS14505 | 2896329..2896430 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| P0083_RS14510 | 2896621..2898891 | - | 2271 | WP_002399785.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| P0083_RS14515 | 2899062..2899562 | + | 501 | WP_002378961.1 | cysteine hydrolase family protein | - |
| P0083_RS14520 | 2900123..2901019 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T274149 WP_021164442.1 NZ_CP119528:c2896430-2896329 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 205 bp
>AT274149 NZ_CP119528:2896171-2896375 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|