Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2750691..2750923 | Replicon | chromosome |
Accession | NZ_CP119159 | ||
Organism | Enterococcus faecalis strain GENOMIC22-006 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | Q837V5 |
Locus tag | P0D81_RS13680 | Protein ID | WP_002366178.1 |
Coordinates | 2750807..2750923 (-) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2750691..2750896 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
P0D81_RS13660 | 2746178..2747266 | - | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
P0D81_RS13665 | 2747285..2748715 | - | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
P0D81_RS13670 | 2748715..2750184 | - | 1470 | WP_002361259.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
P0D81_RS13675 | 2750184..2750489 | - | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
- | 2750691..2750896 | + | 206 | - | - | Antitoxin |
P0D81_RS13680 | 2750807..2750923 | - | 117 | WP_002366178.1 | putative holin-like toxin | Toxin |
P0D81_RS13685 | 2751071..2753101 | - | 2031 | WP_002361258.1 | NAD-dependent DNA ligase LigA | - |
P0D81_RS13690 | 2753227..2755485 | - | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4108.01 Da Isoelectric Point: 5.9482
>T273860 WP_002366178.1 NZ_CP119159:c2750923-2750807 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFVILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFVILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT273860 NZ_CP119159:2750691-2750896 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAA
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAA
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|