Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-RNAII/- |
| Location | 493605..494085 | Replicon | chromosome |
| Accession | NZ_CP119159 | ||
| Organism | Enterococcus faecalis strain GENOMIC22-006 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | P0D81_RS02465 | Protein ID | WP_021164441.1 |
| Coordinates | 493984..494085 (+) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | RNAII | ||
| Locus tag | - | ||
| Coordinates | 493605..493809 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P0D81_RS02445 | 488961..489857 | - | 897 | WP_002354953.1 | YitT family protein | - |
| P0D81_RS02450 | 490418..490918 | - | 501 | WP_002378961.1 | cysteine hydrolase family protein | - |
| P0D81_RS02455 | 491089..493359 | + | 2271 | WP_002399785.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| P0D81_RS02460 | 493550..493651 | + | 102 | WP_021164442.1 | putative holin-like toxin | - |
| - | 493605..493809 | - | 205 | - | - | Antitoxin |
| P0D81_RS02465 | 493984..494085 | + | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| P0D81_RS02470 | 494267..494719 | - | 453 | WP_002378959.1 | YueI family protein | - |
| P0D81_RS02475 | 494904..495851 | + | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| P0D81_RS02480 | 495848..496813 | + | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| P0D81_RS02485 | 496810..497565 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| P0D81_RS02490 | 497604..498557 | + | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T273855 WP_021164441.1 NZ_CP119159:493984-494085 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 205 bp
>AT273855 NZ_CP119159:c493809-493605 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|