Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2632775..2633034 | Replicon | chromosome |
Accession | NZ_CP118962 | ||
Organism | Enterococcus faecalis strain DSM 20478 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | PYW42_RS13035 | Protein ID | WP_075551663.1 |
Coordinates | 2632933..2633034 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2632775..2632984 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PYW42_RS13005 | 2628028..2628981 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
PYW42_RS13010 | 2629020..2629775 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
PYW42_RS13015 | 2629772..2630737 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
PYW42_RS13020 | 2630734..2631681 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
PYW42_RS13025 | 2631866..2632318 | + | 453 | WP_002389410.1 | YueI family protein | - |
PYW42_RS13030 | 2632500..2632601 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
- | 2632775..2632984 | + | 210 | - | - | Antitoxin |
PYW42_RS13035 | 2632933..2633034 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
PYW42_RS13040 | 2633224..2635494 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
PYW42_RS13045 | 2635665..2636165 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
PYW42_RS13050 | 2636564..2637460 | + | 897 | WP_002389477.1 | YitT family protein | - |
PYW42_RS13055 | 2637511..2637909 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T273651 WP_075551663.1 NZ_CP118962:c2633034-2632933 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT273651 NZ_CP118962:2632775-2632984 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|