Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 568288..568520 | Replicon | chromosome |
Accession | NZ_CP118962 | ||
Organism | Enterococcus faecalis strain DSM 20478 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | PYW42_RS02870 | Protein ID | WP_033606579.1 |
Coordinates | 568288..568404 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 568315..568520 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PYW42_RS02860 | 563726..565984 | + | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
PYW42_RS02865 | 566110..568140 | + | 2031 | WP_002389576.1 | NAD-dependent DNA ligase LigA | - |
PYW42_RS02870 | 568288..568404 | + | 117 | WP_033606579.1 | putative holin-like toxin | Toxin |
- | 568315..568520 | - | 206 | - | - | Antitoxin |
PYW42_RS02875 | 568722..569027 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
PYW42_RS02880 | 569027..570496 | + | 1470 | WP_002368026.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
PYW42_RS02885 | 570496..571926 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
PYW42_RS02890 | 571945..573033 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4073.99 Da Isoelectric Point: 5.9482
>T273643 WP_033606579.1 NZ_CP118962:568288-568404 [Enterococcus faecalis]
MLLSVEAALGLMISFAILVVTIIFGILALVLDNKNNRS
MLLSVEAALGLMISFAILVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT273643 NZ_CP118962:c568520-568315 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTATTGCAAAACTAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTATTGCAAAACTAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|