Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2611119..2611378 | Replicon | chromosome |
| Accession | NZ_CP118755 | ||
| Organism | Enterococcus faecalis strain W5 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PWA41_RS12700 | Protein ID | WP_075551663.1 |
| Coordinates | 2611277..2611378 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2611119..2611328 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PWA41_RS12670 (2606369) | 2606369..2607322 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| PWA41_RS12675 (2607361) | 2607361..2608116 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PWA41_RS12680 (2608113) | 2608113..2609078 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PWA41_RS12685 (2609075) | 2609075..2610022 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PWA41_RS12690 (2610207) | 2610207..2610659 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2610685) | 2610685..2610895 | + | 211 | NuclAT_5 | - | - |
| - (2610722) | 2610722..2610899 | + | 178 | NuclAT_4 | - | - |
| PWA41_RS12695 (2610844) | 2610844..2610945 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| - (2611119) | 2611119..2611328 | + | 210 | NuclAT_6 | - | Antitoxin |
| - (2611153) | 2611153..2611332 | + | 180 | NuclAT_3 | - | - |
| PWA41_RS12700 (2611277) | 2611277..2611378 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PWA41_RS12705 (2611568) | 2611568..2613838 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PWA41_RS12710 (2614009) | 2614009..2614509 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
| PWA41_RS12715 (2614812) | 2614812..2615708 | + | 897 | WP_002365354.1 | YitT family protein | - |
| PWA41_RS12720 (2615759) | 2615759..2616157 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T273408 WP_075551663.1 NZ_CP118755:c2611378-2611277 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT273408 NZ_CP118755:2611119-2611328 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|