Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 85627..85886 | Replicon | chromosome |
| Accession | NZ_CP117970 | ||
| Organism | Enterococcus faecalis strain B-537 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PT722_RS00390 | Protein ID | WP_075551663.1 |
| Coordinates | 85785..85886 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 85627..85836 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PT722_RS00360 (80877) | 80877..81830 | - | 954 | WP_002365350.1 | siderophore ABC transporter substrate-binding protein | - |
| PT722_RS00365 (81869) | 81869..82624 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PT722_RS00370 (82621) | 82621..83586 | - | 966 | WP_002365351.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PT722_RS00375 (83583) | 83583..84530 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PT722_RS00380 (84715) | 84715..85167 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (85193) | 85193..85403 | + | 211 | NuclAT_4 | - | - |
| - (85230) | 85230..85407 | + | 178 | NuclAT_3 | - | - |
| PT722_RS00385 (85352) | 85352..85453 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| - (85627) | 85627..85836 | + | 210 | NuclAT_5 | - | Antitoxin |
| - (85661) | 85661..85840 | + | 180 | NuclAT_2 | - | - |
| PT722_RS00390 (85785) | 85785..85886 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PT722_RS00395 (86075) | 86075..88345 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PT722_RS00400 (88516) | 88516..89016 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
| PT722_RS00405 (89415) | 89415..90311 | + | 897 | WP_002365354.1 | YitT family protein | - |
| PT722_RS00410 (90362) | 90362..90760 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T272577 WP_075551663.1 NZ_CP117970:c85886-85785 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT272577 NZ_CP117970:85627-85836 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|