Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2646725..2646948 | Replicon | chromosome |
| Accession | NZ_CP117508 | ||
| Organism | Enterococcus faecalis strain CQJXZ21-077 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PSC78_RS12995 | Protein ID | WP_075551663.1 |
| Coordinates | 2646847..2646948 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2646725..2646902 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PSC78_RS12970 | 2642372..2643325 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| PSC78_RS12975 | 2643364..2644119 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PSC78_RS12980 | 2644116..2645081 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PSC78_RS12985 | 2645078..2646025 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PSC78_RS12990 | 2646210..2646662 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - | 2646725..2646902 | + | 178 | - | - | Antitoxin |
| PSC78_RS12995 | 2646847..2646948 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PSC78_RS13000 | 2647280..2647381 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| PSC78_RS13005 | 2647571..2649841 | - | 2271 | WP_002392683.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PSC78_RS13010 | 2650012..2650512 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T271270 WP_075551663.1 NZ_CP117508:c2646948-2646847 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 178 bp
>AT271270 NZ_CP117508:2646725-2646902 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|