Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2567434..2567691 | Replicon | chromosome |
| Accession | NZ_CP117503 | ||
| Organism | Enterococcus faecalis strain CQJXZ21-076 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PSC77_RS12385 | Protein ID | WP_021164441.1 |
| Coordinates | 2567590..2567691 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2567434..2567641 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PSC77_RS12360 (2563118) | 2563118..2564071 | - | 954 | WP_010709946.1 | siderophore ABC transporter substrate-binding protein | - |
| PSC77_RS12365 (2564110) | 2564110..2564865 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PSC77_RS12370 (2564862) | 2564862..2565827 | - | 966 | WP_016622541.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PSC77_RS12375 (2565824) | 2565824..2566771 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PSC77_RS12380 (2566956) | 2566956..2567408 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - (2567434) | 2567434..2567641 | + | 208 | NuclAT_3 | - | Antitoxin |
| - (2567471) | 2567471..2567645 | + | 175 | NuclAT_6 | - | - |
| PSC77_RS12385 (2567590) | 2567590..2567691 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| - (2567866) | 2567866..2568075 | + | 210 | NuclAT_4 | - | - |
| - (2567900) | 2567900..2568079 | + | 180 | NuclAT_5 | - | - |
| PSC77_RS12390 (2568024) | 2568024..2568125 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| PSC77_RS12395 (2568313) | 2568313..2570583 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PSC77_RS12400 (2570754) | 2570754..2571254 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T271249 WP_021164441.1 NZ_CP117503:c2567691-2567590 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 208 bp
>AT271249 NZ_CP117503:2567434-2567641 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|