Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 135419..135844 | Replicon | plasmid pCUVM3.1 |
| Accession | NZ_CP116971 | ||
| Organism | Escherichia coli strain CUVM3 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | PQP09_RS24800 | Protein ID | WP_223195199.1 |
| Coordinates | 135419..135541 (-) | Length | 41 a.a. |
Antitoxin (RNA)
| Gene name | srnC | ||
| Locus tag | - | ||
| Coordinates | 135633..135844 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP09_RS24765 (130581) | 130581..131402 | - | 822 | WP_061856956.1 | DUF932 domain-containing protein | - |
| PQP09_RS24770 (131521) | 131521..131808 | - | 288 | WP_000107543.1 | hypothetical protein | - |
| PQP09_RS24775 (131833) | 131833..132039 | - | 207 | WP_024189527.1 | hypothetical protein | - |
| PQP09_RS24780 (132109) | 132109..132406 | + | 298 | Protein_144 | hypothetical protein | - |
| PQP09_RS24785 (132504) | 132504..133154 | + | 651 | WP_000993956.1 | IS66-like element accessory protein TnpA | - |
| PQP09_RS24790 (133154) | 133154..133501 | + | 348 | WP_000624622.1 | IS66 family insertion sequence element accessory protein TnpB | - |
| PQP09_RS24795 (133521) | 133521..135092 | + | 1572 | WP_094083869.1 | IS66-like element ISCro1 family transposase | - |
| PQP09_RS24800 (135419) | 135419..135541 | - | 123 | WP_223195199.1 | Hok/Gef family protein | Toxin |
| PQP09_RS24805 (135486) | 135486..135599 | - | 114 | Protein_149 | DUF5431 family protein | - |
| - (135633) | 135633..135844 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (135633) | 135633..135844 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (135633) | 135633..135844 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (135633) | 135633..135844 | - | 212 | NuclAT_0 | - | Antitoxin |
| PQP09_RS24810 (135789) | 135789..136575 | - | 787 | Protein_150 | plasmid SOS inhibition protein A | - |
| PQP09_RS24815 (136572) | 136572..137006 | - | 435 | WP_000845926.1 | conjugation system SOS inhibitor PsiB | - |
| PQP09_RS24820 (137061) | 137061..139020 | - | 1960 | Protein_152 | ParB/RepB/Spo0J family partition protein | - |
| PQP09_RS24825 (139086) | 139086..139319 | - | 234 | WP_000006002.1 | DUF905 family protein | - |
| PQP09_RS24830 (139377) | 139377..139805 | - | 429 | WP_063115590.1 | single-stranded DNA-binding protein | - |
| PQP09_RS24835 (140505) | 140505..140696 | - | 192 | WP_025269849.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Conjugative plasmid | - | - | 1..164599 | 164599 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 41 a.a. Molecular weight: 4536.35 Da Isoelectric Point: 8.2691
>T269575 WP_223195199.1 NZ_CP116971:c135541-135419 [Escherichia coli]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
Download Length: 123 bp
Antitoxin
Download Length: 212 bp
>AT269575 NZ_CP116971:c135844-135633 [Escherichia coli]
TCACACGGATTACCCGTGAACTGGTTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
TCACACGGATTACCCGTGAACTGGTTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|