Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 429053..429314 | Replicon | chromosome |
| Accession | NZ_CP116962 | ||
| Organism | Enterococcus faecalis strain DM86 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PO880_RS01975 | Protein ID | WP_021164442.1 |
| Coordinates | 429053..429154 (+) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 429108..429314 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PO880_RS01955 | 424380..424778 | + | 399 | WP_002354951.1 | glyoxalase | - |
| PO880_RS01960 | 424829..425725 | - | 897 | WP_002365354.1 | YitT family protein | - |
| PO880_RS01965 | 425915..426421 | - | 507 | WP_010710886.1 | cysteine hydrolase family protein | - |
| PO880_RS01970 | 426592..428862 | + | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PO880_RS01975 | 429053..429154 | + | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| - | 429108..429314 | - | 207 | - | - | Antitoxin |
| PO880_RS01980 | 429340..429792 | - | 453 | WP_010710887.1 | YueI family protein | - |
| PO880_RS01985 | 429977..430924 | + | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PO880_RS01990 | 430921..431886 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PO880_RS01995 | 431883..432638 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PO880_RS02000 | 432677..433630 | + | 954 | WP_002408267.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T269542 WP_021164442.1 NZ_CP116962:429053-429154 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 207 bp
>AT269542 NZ_CP116962:c429314-429108 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|