Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2683724..2683949 | Replicon | chromosome |
| Accession | NZ_CP116571 | ||
| Organism | Enterococcus faecalis strain K190-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PML73_RS13305 | Protein ID | WP_075551663.1 |
| Coordinates | 2683848..2683949 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2683724..2683903 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PML73_RS13275 | 2678943..2679896 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| PML73_RS13275 | 2678943..2679896 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| PML73_RS13280 | 2679935..2680690 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PML73_RS13280 | 2679935..2680690 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PML73_RS13285 | 2680687..2681652 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML73_RS13285 | 2680687..2681652 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML73_RS13290 | 2681649..2682596 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML73_RS13290 | 2681649..2682596 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML73_RS13295 | 2682781..2683233 | + | 453 | WP_002389410.1 | YueI family protein | - |
| PML73_RS13295 | 2682781..2683233 | + | 453 | WP_002389410.1 | YueI family protein | - |
| PML73_RS13300 | 2683415..2683516 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| PML73_RS13300 | 2683415..2683516 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - | 2683724..2683903 | + | 180 | - | - | Antitoxin |
| PML73_RS13305 | 2683848..2683949 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PML73_RS13305 | 2683848..2683949 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PML73_RS13310 | 2684139..2686409 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML73_RS13310 | 2684139..2686409 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML73_RS13315 | 2686580..2687080 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
| PML73_RS13315 | 2686580..2687080 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
| PML73_RS13320 | 2687479..2688375 | + | 897 | WP_002389477.1 | YitT family protein | - |
| PML73_RS13320 | 2687479..2688375 | + | 897 | WP_002389477.1 | YitT family protein | - |
| PML73_RS13325 | 2688426..2688824 | - | 399 | WP_002354951.1 | glyoxalase | - |
| PML73_RS13325 | 2688426..2688824 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T269011 WP_075551663.1 NZ_CP116571:c2683949-2683848 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT269011 NZ_CP116571:2683724-2683903 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|