Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2486525..2486785 | Replicon | chromosome |
| Accession | NZ_CP116569 | ||
| Organism | Enterococcus faecalis strain K198-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PML91_RS11840 | Protein ID | WP_075551663.1 |
| Coordinates | 2486684..2486785 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2486525..2486735 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PML91_RS11815 | 2482209..2483162 | - | 954 | WP_231432877.1 | siderophore ABC transporter substrate-binding protein | - |
| PML91_RS11820 | 2483201..2483956 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| PML91_RS11825 | 2483953..2484918 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML91_RS11830 | 2484915..2485862 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML91_RS11835 | 2486047..2486499 | + | 453 | WP_010710887.1 | YueI family protein | - |
| - | 2486525..2486735 | + | 211 | - | - | Antitoxin |
| PML91_RS11840 | 2486684..2486785 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| PML91_RS11845 | 2486974..2489244 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML91_RS11850 | 2489415..2489915 | + | 501 | WP_016627679.1 | cysteine hydrolase family protein | - |
| PML91_RS11855 | 2490261..2491157 | + | 897 | WP_002365354.1 | YitT family protein | - |
| PML91_RS11860 | 2491208..2491606 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T268983 WP_075551663.1 NZ_CP116569:c2486785-2486684 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT268983 NZ_CP116569:2486525-2486735 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|