Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2534466..2534943 | Replicon | chromosome |
| Accession | NZ_CP116566 | ||
| Organism | Enterococcus faecalis strain K191-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PML79_RS12295 | Protein ID | WP_162780856.1 |
| Coordinates | 2534466..2534567 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2534742..2534943 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PML79_RS12270 (2529961) | 2529961..2530914 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| PML79_RS12275 (2530953) | 2530953..2531708 | - | 756 | WP_010776168.1 | ATP-binding cassette domain-containing protein | - |
| PML79_RS12280 (2531705) | 2531705..2532670 | - | 966 | WP_085443086.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML79_RS12285 (2532667) | 2532667..2533614 | - | 948 | WP_085443087.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML79_RS12290 (2533799) | 2533799..2534251 | + | 453 | WP_010707017.1 | YueI family protein | - |
| - (2534307) | 2534307..2534512 | + | 206 | NuclAT_4 | - | - |
| - (2534344) | 2534344..2534529 | + | 186 | NuclAT_9 | - | - |
| PML79_RS12295 (2534466) | 2534466..2534567 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
| - (2534742) | 2534742..2534943 | + | 202 | NuclAT_3 | - | Antitoxin |
| - (2534776) | 2534776..2534960 | + | 185 | NuclAT_8 | - | - |
| PML79_RS12300 (2534897) | 2534897..2534998 | - | 102 | WP_224800345.1 | putative holin-like toxin | - |
| PML79_RS12305 (2535187) | 2535187..2537457 | - | 2271 | WP_085443088.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML79_RS12310 (2537628) | 2537628..2538134 | + | 507 | WP_010824004.1 | cysteine hydrolase family protein | - |
| PML79_RS12315 (2538324) | 2538324..2539220 | + | 897 | WP_002354953.1 | YitT family protein | - |
| PML79_RS12320 (2539271) | 2539271..2539669 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T268963 WP_162780856.1 NZ_CP116566:c2534567-2534466 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 202 bp
>AT268963 NZ_CP116566:2534742-2534943 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|