Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2584626..2585103 | Replicon | chromosome |
Accession | NZ_CP116564 | ||
Organism | Enterococcus faecalis strain K188-1 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | PML72_RS12690 | Protein ID | WP_162780856.1 |
Coordinates | 2584626..2584727 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2584902..2585103 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PML72_RS12665 (2580121) | 2580121..2581074 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
PML72_RS12670 (2581113) | 2581113..2581868 | - | 756 | WP_010776168.1 | ATP-binding cassette domain-containing protein | - |
PML72_RS12675 (2581865) | 2581865..2582830 | - | 966 | WP_085443086.1 | iron chelate uptake ABC transporter family permease subunit | - |
PML72_RS12680 (2582827) | 2582827..2583774 | - | 948 | WP_085443087.1 | iron chelate uptake ABC transporter family permease subunit | - |
PML72_RS12685 (2583959) | 2583959..2584411 | + | 453 | WP_010707017.1 | YueI family protein | - |
- (2584467) | 2584467..2584672 | + | 206 | NuclAT_4 | - | - |
- (2584504) | 2584504..2584689 | + | 186 | NuclAT_9 | - | - |
PML72_RS12690 (2584626) | 2584626..2584727 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
- (2584902) | 2584902..2585103 | + | 202 | NuclAT_3 | - | Antitoxin |
- (2584936) | 2584936..2585120 | + | 185 | NuclAT_8 | - | - |
PML72_RS12695 (2585057) | 2585057..2585158 | - | 102 | WP_224800345.1 | putative holin-like toxin | - |
PML72_RS12700 (2585347) | 2585347..2587617 | - | 2271 | WP_085443088.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
PML72_RS12705 (2587788) | 2587788..2588294 | + | 507 | WP_010824004.1 | cysteine hydrolase family protein | - |
PML72_RS12710 (2588484) | 2588484..2589380 | + | 897 | WP_002354953.1 | YitT family protein | - |
PML72_RS12715 (2589431) | 2589431..2589829 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T268941 WP_162780856.1 NZ_CP116564:c2584727-2584626 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 202 bp
>AT268941 NZ_CP116564:2584902-2585103 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|