Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2583479..2583956 | Replicon | chromosome |
| Accession | NZ_CP116561 | ||
| Organism | Enterococcus faecalis strain K72-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PML97_RS12675 | Protein ID | WP_162780856.1 |
| Coordinates | 2583479..2583580 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2583755..2583956 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PML97_RS12650 (2578974) | 2578974..2579927 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| PML97_RS12655 (2579966) | 2579966..2580721 | - | 756 | WP_010776168.1 | ATP-binding cassette domain-containing protein | - |
| PML97_RS12660 (2580718) | 2580718..2581683 | - | 966 | WP_085443086.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML97_RS12665 (2581680) | 2581680..2582627 | - | 948 | WP_085443087.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML97_RS12670 (2582812) | 2582812..2583264 | + | 453 | WP_010707017.1 | YueI family protein | - |
| - (2583320) | 2583320..2583525 | + | 206 | NuclAT_4 | - | - |
| - (2583357) | 2583357..2583542 | + | 186 | NuclAT_9 | - | - |
| PML97_RS12675 (2583479) | 2583479..2583580 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
| - (2583755) | 2583755..2583956 | + | 202 | NuclAT_3 | - | Antitoxin |
| - (2583789) | 2583789..2583973 | + | 185 | NuclAT_8 | - | - |
| PML97_RS12680 (2583910) | 2583910..2584011 | - | 102 | WP_224800345.1 | putative holin-like toxin | - |
| PML97_RS12685 (2584200) | 2584200..2586470 | - | 2271 | WP_085443088.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML97_RS12690 (2586641) | 2586641..2587147 | + | 507 | WP_010824004.1 | cysteine hydrolase family protein | - |
| PML97_RS12695 (2587337) | 2587337..2588233 | + | 897 | WP_002354953.1 | YitT family protein | - |
| PML97_RS12700 (2588284) | 2588284..2588682 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T268918 WP_162780856.1 NZ_CP116561:c2583580-2583479 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 202 bp
>AT268918 NZ_CP116561:2583755-2583956 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|