Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2504953..2505214 | Replicon | chromosome |
Accession | NZ_CP116555 | ||
Organism | Enterococcus faecalis strain K70-12a |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | PML75_RS11880 | Protein ID | WP_162780856.1 |
Coordinates | 2505113..2505214 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2504953..2505159 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PML75_RS11855 (2500608) | 2500608..2501561 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
PML75_RS11860 (2501600) | 2501600..2502355 | - | 756 | WP_002375575.1 | ATP-binding cassette domain-containing protein | - |
PML75_RS11865 (2502352) | 2502352..2503317 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
PML75_RS11870 (2503314) | 2503314..2504261 | - | 948 | WP_002375573.1 | iron chelate uptake ABC transporter family permease subunit | - |
PML75_RS11875 (2504445) | 2504445..2504897 | + | 453 | WP_002375572.1 | YueI family protein | - |
- (2504953) | 2504953..2505159 | + | 207 | NuclAT_7 | - | Antitoxin |
- (2504990) | 2504990..2505176 | + | 187 | NuclAT_9 | - | - |
PML75_RS11880 (2505113) | 2505113..2505214 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
PML75_RS11885 (2505406) | 2505406..2507676 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
PML75_RS11890 (2507847) | 2507847..2508347 | + | 501 | WP_002395960.1 | cysteine hydrolase family protein | - |
PML75_RS11895 (2509146) | 2509146..2510042 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T268865 WP_162780856.1 NZ_CP116555:c2505214-2505113 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 207 bp
>AT268865 NZ_CP116555:2504953-2505159 [Enterococcus faecalis]
TTCCATTTATAATAGAATTGTGCTATTATGAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGG
TTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTATAATAGAATTGTGCTATTATGAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGG
TTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|