Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 1756676..1756899 | Replicon | chromosome |
Accession | NZ_CP115992 | ||
Organism | Enterococcus faecalis strain ESC1 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | PE069_RS08435 | Protein ID | WP_021164442.1 |
Coordinates | 1756798..1756899 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 1756676..1756861 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PE069_RS08410 (1752293) | 1752293..1753246 | - | 954 | WP_271232295.1 | siderophore ABC transporter substrate-binding protein | - |
PE069_RS08415 (1753285) | 1753285..1754040 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
PE069_RS08420 (1754037) | 1754037..1755002 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
PE069_RS08425 (1754999) | 1754999..1755946 | - | 948 | WP_002368428.1 | iron chelate uptake ABC transporter family permease subunit | - |
PE069_RS08430 (1756131) | 1756131..1756583 | + | 453 | WP_002359057.1 | YueI family protein | - |
- (1756639) | 1756639..1756844 | + | 206 | NuclAT_7 | - | - |
- (1756676) | 1756676..1756861 | + | 186 | NuclAT_5 | - | Antitoxin |
PE069_RS08435 (1756798) | 1756798..1756899 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
- (1757074) | 1757074..1757283 | + | 210 | NuclAT_6 | - | - |
- (1757108) | 1757108..1757287 | + | 180 | NuclAT_4 | - | - |
PE069_RS08440 (1757232) | 1757232..1757333 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
PE069_RS08445 (1757522) | 1757522..1759792 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
PE069_RS08450 (1759963) | 1759963..1760463 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
PE069_RS08455 (1760809) | 1760809..1761705 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T267566 WP_021164442.1 NZ_CP115992:c1756899-1756798 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 186 bp
>AT267566 NZ_CP115992:1756676-1756861 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCATTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAACGCAACAAGGGTTGCA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCATTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAACGCAACAAGGGTTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|