Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | yonT-as-bsrH/- |
| Location | 2221501..2221988 | Replicon | chromosome |
| Accession | NZ_CP115738 | ||
| Organism | Bacillus subtilis strain W7 | ||
Toxin (Protein)
| Gene name | yonT | Uniprot ID | - |
| Locus tag | OSK17_RS11480 | Protein ID | WP_109962751.1 |
| Coordinates | 2221501..2221752 (-) | Length | 84 a.a. |
Antitoxin (RNA)
| Gene name | as-bsrH | ||
| Locus tag | - | ||
| Coordinates | 2221888..2221988 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OSK17_RS11435 (2216510) | 2216510..2216830 | - | 321 | WP_271069210.1 | hypothetical protein | - |
| OSK17_RS11440 (2216868) | 2216868..2217164 | - | 297 | WP_114168604.1 | hypothetical protein | - |
| OSK17_RS11445 (2217244) | 2217244..2217441 | - | 198 | WP_271069211.1 | hypothetical protein | - |
| OSK17_RS11450 (2217454) | 2217454..2217690 | - | 237 | WP_271069212.1 | hypothetical protein | - |
| OSK17_RS11455 (2217690) | 2217690..2218073 | - | 384 | WP_271069213.1 | hypothetical protein | - |
| OSK17_RS11460 (2218110) | 2218110..2218976 | - | 867 | WP_271069214.1 | hypothetical protein | - |
| OSK17_RS11465 (2219121) | 2219121..2219552 | - | 432 | WP_109962749.1 | hypothetical protein | - |
| OSK17_RS11470 (2219969) | 2219969..2221186 | - | 1218 | WP_109962750.1 | hypothetical protein | - |
| OSK17_RS11475 (2221268) | 2221268..2221456 | - | 189 | WP_003230987.1 | hypothetical protein | - |
| OSK17_RS11480 (2221501) | 2221501..2221752 | - | 252 | WP_109962751.1 | hypothetical protein | Toxin |
| OSK17_RS11485 (2221771) | 2221771..2221947 | - | 177 | WP_109962752.1 | hypothetical protein | - |
| - (2221888) | 2221888..2221988 | + | 101 | NuclAT_1 | - | Antitoxin |
| - (2221888) | 2221888..2221988 | + | 101 | NuclAT_1 | - | Antitoxin |
| - (2221888) | 2221888..2221988 | + | 101 | NuclAT_1 | - | Antitoxin |
| - (2221888) | 2221888..2221988 | + | 101 | NuclAT_1 | - | Antitoxin |
| OSK17_RS11490 (2222979) | 2222979..2223173 | + | 195 | WP_004399291.1 | hypothetical protein | - |
| OSK17_RS11495 (2223213) | 2223213..2225720 | + | 2508 | WP_109962753.1 | DNA-directed RNA polymerase YonO | - |
| OSK17_RS11500 (2225984) | 2225984..2226259 | + | 276 | WP_072692660.1 | HU family DNA-binding protein | - |
| OSK17_RS11505 (2226682) | 2226682..2226793 | + | 112 | Protein_2213 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2154124..2285049 | 130925 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 84 a.a. Molecular weight: 10072.08 Da Isoelectric Point: 10.0301
>T267361 WP_109962751.1 NZ_CP115738:c2221752-2221501 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSNEAQTLINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSNEAQTLINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
Download Length: 252 bp
Antitoxin
Download Length: 101 bp
>AT267361 NZ_CP115738:2221888-2221988 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTATAATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTATAATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
