Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 2323689..2323886 | Replicon | chromosome |
| Accession | NC_017342 | ||
| Organism | Staphylococcus aureus subsp. aureus TCH60 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | HMPREF0772_RS11690 | Protein ID | WP_000623369.1 |
| Coordinates | 2323779..2323886 (-) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF3 | ||
| Locus tag | - | ||
| Coordinates | 2323689..2323726 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HMPREF0772_RS11660 | 2318882..2319169 | - | 288 | WP_000410718.1 | hypothetical protein | - |
| HMPREF0772_RS14835 | 2319510..2319800 | + | 291 | WP_001791476.1 | hypothetical protein | - |
| HMPREF0772_RS11670 | 2319888..2320529 | - | 642 | WP_000571183.1 | ABC transporter ATP-binding protein | - |
| HMPREF0772_RS11675 | 2320526..2320846 | - | 321 | WP_000873929.1 | YxeA family protein | - |
| HMPREF0772_RS11680 | 2320849..2322813 | - | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
| HMPREF0772_RS14840 | 2322857..2323129 | - | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
| HMPREF0772_RS11685 | 2323139..2323240 | - | 102 | WP_001790623.1 | hypothetical protein | - |
| - | 2323689..2323726 | + | 38 | - | - | Antitoxin |
| HMPREF0772_RS11690 | 2323779..2323886 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
| HMPREF0772_RS11695 | 2324157..2324759 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
| HMPREF0772_RS11700 | 2324774..2324950 | - | 177 | WP_000214898.1 | YkvS family protein | - |
| HMPREF0772_RS11705 | 2325149..2326135 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
| HMPREF0772_RS11710 | 2326216..2326434 | - | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
| HMPREF0772_RS11715 | 2326644..2327213 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T26677 WP_000623369.1 NC_017342:c2323886-2323779 [Staphylococcus aureus subsp. aureus TCH60]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T26677 NC_017342:c2323886-2323779 [Staphylococcus aureus subsp. aureus TCH60]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 38 bp
>AT26677 NC_017342:2323689-2323726 [Staphylococcus aureus subsp. aureus TCH60]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|