Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2547981..2548240 | Replicon | chromosome |
| Accession | NZ_CP113832 | ||
| Organism | Enterococcus faecalis strain M61 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OZF29_RS12370 | Protein ID | WP_021164442.1 |
| Coordinates | 2548139..2548240 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2547981..2548185 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OZF29_RS12340 (2543234) | 2543234..2544187 | - | 954 | WP_116495158.1 | siderophore ABC transporter substrate-binding protein | - |
| OZF29_RS12345 (2544226) | 2544226..2544981 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OZF29_RS12350 (2544978) | 2544978..2545943 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OZF29_RS12355 (2545940) | 2545940..2546887 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OZF29_RS12360 (2547071) | 2547071..2547523 | + | 453 | WP_010707017.1 | YueI family protein | - |
| - (2547549) | 2547549..2547756 | + | 208 | NuclAT_11 | - | - |
| - (2547586) | 2547586..2547760 | + | 175 | NuclAT_20 | - | - |
| OZF29_RS12365 (2547705) | 2547705..2547806 | - | 102 | WP_228088368.1 | putative holin-like toxin | - |
| - (2547981) | 2547981..2548185 | + | 205 | NuclAT_12 | - | Antitoxin |
| - (2548015) | 2548015..2548202 | + | 188 | NuclAT_19 | - | - |
| OZF29_RS12370 (2548139) | 2548139..2548240 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| OZF29_RS12375 (2548431) | 2548431..2550701 | - | 2271 | WP_116495157.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OZF29_RS12380 (2550872) | 2550872..2551372 | + | 501 | WP_002378961.1 | cysteine hydrolase family protein | - |
| OZF29_RS12385 (2551718) | 2551718..2552614 | + | 897 | WP_002354953.1 | YitT family protein | - |
| OZF29_RS12390 (2552665) | 2552665..2553063 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T266110 WP_021164442.1 NZ_CP113832:c2548240-2548139 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 205 bp
>AT266110 NZ_CP113832:2547981-2548185 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGTGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGTGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|