Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2782786..2783045 | Replicon | chromosome |
Accession | NZ_CP113831 | ||
Organism | Enterococcus faecalis strain T30 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OZE10_RS14160 | Protein ID | WP_075551663.1 |
Coordinates | 2782944..2783045 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2782786..2782995 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OZE10_RS14130 (2778036) | 2778036..2778989 | - | 954 | WP_002394760.1 | siderophore ABC transporter substrate-binding protein | - |
OZE10_RS14135 (2779028) | 2779028..2779783 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OZE10_RS14140 (2779780) | 2779780..2780745 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
OZE10_RS14145 (2780742) | 2780742..2781689 | - | 948 | WP_002359058.1 | iron chelate uptake ABC transporter family permease subunit | - |
OZE10_RS14150 (2781874) | 2781874..2782326 | + | 453 | WP_002359057.1 | YueI family protein | - |
- (2782352) | 2782352..2782562 | + | 211 | NuclAT_6 | - | - |
- (2782389) | 2782389..2782566 | + | 178 | NuclAT_5 | - | - |
OZE10_RS14155 (2782511) | 2782511..2782612 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
- (2782786) | 2782786..2782995 | + | 210 | NuclAT_7 | - | Antitoxin |
- (2782820) | 2782820..2782999 | + | 180 | NuclAT_4 | - | - |
OZE10_RS14160 (2782944) | 2782944..2783045 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
OZE10_RS14165 (2783235) | 2783235..2785505 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OZE10_RS14170 (2785676) | 2785676..2786176 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
OZE10_RS14175 (2786479) | 2786479..2787375 | + | 897 | WP_002354953.1 | YitT family protein | - |
OZE10_RS14180 (2787426) | 2787426..2787824 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T266088 WP_075551663.1 NZ_CP113831:c2783045-2782944 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT266088 NZ_CP113831:2782786-2782995 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|