Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1079044..1079293 | Replicon | chromosome |
Accession | NC_017333 | ||
Organism | Staphylococcus aureus subsp. aureus ST398 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SAPIG_RS05340 | Protein ID | WP_000623369.1 |
Coordinates | 1079044..1079151 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1079146..1079293 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SAPIG_RS05315 | 1075718..1076287 | - | 570 | WP_000287260.1 | competence protein ComK | - |
SAPIG_RS05320 | 1076497..1076715 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
SAPIG_RS05325 | 1076796..1077782 | - | 987 | WP_000668814.1 | lipoate--protein ligase | - |
SAPIG_RS05330 | 1077981..1078157 | + | 177 | WP_000214898.1 | YkvS family protein | - |
SAPIG_RS05335 | 1078172..1078774 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SAPIG_RS05340 | 1079044..1079151 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1079146..1079293 | - | 148 | - | - | Antitoxin |
SAPIG_RS05345 | 1079786..1080070 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
SAPIG_RS05350 | 1080114..1082078 | + | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
SAPIG_RS05355 | 1082081..1082401 | + | 321 | WP_000668623.1 | YxeA family protein | - |
SAPIG_RS05360 | 1082398..1083039 | + | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
SAPIG_RS15015 | 1083127..1083417 | - | 291 | WP_001796515.1 | hypothetical protein | - |
SAPIG_RS15020 | 1083507..1083695 | + | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
SAPIG_RS05370 | 1083784..1084140 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T26577 WP_000623369.1 NC_017333:1079044-1079151 [Staphylococcus aureus subsp. aureus ST398]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T26577 NC_017333:1079044-1079151 [Staphylococcus aureus subsp. aureus ST398]
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT26577 NC_017333:c1079293-1079146 [Staphylococcus aureus subsp. aureus ST398]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|