Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2580008..2580267 | Replicon | chromosome |
Accession | NZ_CP110289 | ||
Organism | Enterococcus faecalis strain AKSZ-208 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | MZO28_RS12860 | Protein ID | WP_075551663.1 |
Coordinates | 2580166..2580267 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2580008..2580217 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MZO28_RS12830 | 2575261..2576214 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
MZO28_RS12835 | 2576253..2577008 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
MZO28_RS12840 | 2577005..2577970 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
MZO28_RS12845 | 2577967..2578914 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
MZO28_RS12850 | 2579099..2579551 | + | 453 | WP_002389410.1 | YueI family protein | - |
MZO28_RS12855 | 2579733..2579834 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
- | 2580008..2580217 | + | 210 | - | - | Antitoxin |
MZO28_RS12860 | 2580166..2580267 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
MZO28_RS12865 | 2580457..2582727 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
MZO28_RS12870 | 2582898..2583398 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
MZO28_RS12875 | 2583797..2584693 | + | 897 | WP_002389477.1 | YitT family protein | - |
MZO28_RS12880 | 2584744..2585142 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T263565 WP_075551663.1 NZ_CP110289:c2580267-2580166 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT263565 NZ_CP110289:2580008-2580217 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|