Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 404139..404400 | Replicon | chromosome |
Accession | NZ_CP110071 | ||
Organism | Enterococcus faecalis strain BE8 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OLL94_RS01895 | Protein ID | WP_224561205.1 |
Coordinates | 404139..404240 (+) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 404189..404400 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLL94_RS01875 | 399466..399864 | + | 399 | WP_002354951.1 | glyoxalase | - |
OLL94_RS01880 | 399915..400811 | - | 897 | WP_002365354.1 | YitT family protein | - |
OLL94_RS01885 | 401001..401507 | - | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
OLL94_RS01890 | 401678..403948 | + | 2271 | WP_002378809.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OLL94_RS01895 | 404139..404240 | + | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
- | 404189..404400 | - | 212 | - | - | Antitoxin |
OLL94_RS01900 | 404426..404878 | - | 453 | WP_002378807.1 | YueI family protein | - |
OLL94_RS01905 | 405063..406010 | + | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL94_RS01910 | 406007..406972 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL94_RS01915 | 406969..407724 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OLL94_RS01920 | 407763..408716 | + | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T263031 WP_224561205.1 NZ_CP110071:404139-404240 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 212 bp
>AT263031 NZ_CP110071:c404400-404189 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|