Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2647363..2647588 | Replicon | chromosome |
| Accession | NZ_CP110069 | ||
| Organism | Enterococcus faecalis strain BE11 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OLL93_RS12875 | Protein ID | WP_075551663.1 |
| Coordinates | 2647487..2647588 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2647363..2647542 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OLL93_RS12845 | 2642579..2643532 | - | 954 | WP_264522659.1 | siderophore ABC transporter substrate-binding protein | - |
| OLL93_RS12850 | 2643571..2644326 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OLL93_RS12855 | 2644323..2645288 | - | 966 | WP_002365351.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL93_RS12860 | 2645285..2646232 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL93_RS12865 | 2646417..2646869 | + | 453 | WP_002354958.1 | YueI family protein | - |
| OLL93_RS12870 | 2647054..2647155 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| - | 2647363..2647542 | + | 180 | - | - | Antitoxin |
| OLL93_RS12875 | 2647487..2647588 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| OLL93_RS12880 | 2647777..2650047 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OLL93_RS12885 | 2650218..2650718 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
| OLL93_RS12890 | 2651117..2652013 | + | 897 | WP_002365354.1 | YitT family protein | - |
| OLL93_RS12895 | 2652064..2652462 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Integrative and Conjugative Element | tet(M) | - | 2639637..2688562 | 48925 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T263014 WP_075551663.1 NZ_CP110069:c2647588-2647487 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT263014 NZ_CP110069:2647363-2647542 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|