Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2737895..2738152 | Replicon | chromosome |
| Accession | NZ_CP110068 | ||
| Organism | Enterococcus faecalis strain BE13 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OLM02_RS13435 | Protein ID | WP_075551663.1 |
| Coordinates | 2738051..2738152 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2737895..2738102 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OLM02_RS13410 | 2733579..2734532 | - | 954 | WP_010821905.1 | siderophore ABC transporter substrate-binding protein | - |
| OLM02_RS13415 | 2734571..2735326 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OLM02_RS13420 | 2735323..2736288 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLM02_RS13425 | 2736285..2737232 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLM02_RS13430 | 2737417..2737869 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - | 2737895..2738102 | + | 208 | - | - | Antitoxin |
| OLM02_RS13435 | 2738051..2738152 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| OLM02_RS13440 | 2738341..2740611 | - | 2271 | WP_010821906.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OLM02_RS13445 | 2740782..2741288 | + | 507 | WP_002406481.1 | cysteine hydrolase family protein | - |
| OLM02_RS13450 | 2741478..2742374 | + | 897 | WP_002354953.1 | YitT family protein | - |
| OLM02_RS13455 | 2742425..2742823 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262993 WP_075551663.1 NZ_CP110068:c2738152-2738051 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 208 bp
>AT262993 NZ_CP110068:2737895-2738102 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|