Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2665241..2665500 | Replicon | chromosome |
| Accession | NZ_CP110063 | ||
| Organism | Enterococcus faecalis strain BE15 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OLL96_RS13100 | Protein ID | WP_075551663.1 |
| Coordinates | 2665399..2665500 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2665241..2665450 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OLL96_RS13070 | 2660494..2661447 | - | 954 | WP_264526425.1 | siderophore ABC transporter substrate-binding protein | - |
| OLL96_RS13075 | 2661486..2662241 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OLL96_RS13080 | 2662238..2663203 | - | 966 | WP_174092882.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL96_RS13085 | 2663200..2664147 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL96_RS13090 | 2664332..2664784 | + | 453 | WP_002389410.1 | YueI family protein | - |
| OLL96_RS13095 | 2664966..2665067 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - | 2665241..2665450 | + | 210 | - | - | Antitoxin |
| OLL96_RS13100 | 2665399..2665500 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| OLL96_RS13105 | 2665690..2667960 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OLL96_RS13110 | 2668131..2668631 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
| OLL96_RS13115 | 2669030..2669926 | + | 897 | WP_002389477.1 | YitT family protein | - |
| OLL96_RS13120 | 2669977..2670375 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262969 WP_075551663.1 NZ_CP110063:c2665500-2665399 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT262969 NZ_CP110063:2665241-2665450 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|