Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2618999..2619259 | Replicon | chromosome |
Accession | NZ_CP110054 | ||
Organism | Enterococcus faecalis strain BE17 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OLL95_RS12800 | Protein ID | WP_075551663.1 |
Coordinates | 2619158..2619259 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2618999..2619209 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLL95_RS12775 (2614683) | 2614683..2615636 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
OLL95_RS12780 (2615675) | 2615675..2616430 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OLL95_RS12785 (2616427) | 2616427..2617392 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL95_RS12790 (2617389) | 2617389..2618336 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL95_RS12795 (2618521) | 2618521..2618973 | + | 453 | WP_002354958.1 | YueI family protein | - |
- (2618999) | 2618999..2619209 | + | 211 | NuclAT_3 | - | Antitoxin |
- (2619036) | 2619036..2619213 | + | 178 | NuclAT_9 | - | - |
OLL95_RS12800 (2619158) | 2619158..2619259 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
OLL95_RS12805 (2619448) | 2619448..2621718 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OLL95_RS12810 (2621889) | 2621889..2622389 | + | 501 | WP_002361021.1 | cysteine hydrolase family protein | - |
OLL95_RS12815 (2622944) | 2622944..2623840 | + | 897 | WP_104875316.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262919 WP_075551663.1 NZ_CP110054:c2619259-2619158 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT262919 NZ_CP110054:2618999-2619209 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|