Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2513334..2513819 | Replicon | chromosome |
| Accession | NZ_CP110053 | ||
| Organism | Enterococcus faecalis strain BE25 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OLL87_RS12130 | Protein ID | WP_021164441.1 |
| Coordinates | 2513334..2513435 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2513610..2513819 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OLL87_RS12105 (2508862) | 2508862..2509815 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| OLL87_RS12110 (2509854) | 2509854..2510609 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OLL87_RS12115 (2510606) | 2510606..2511571 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL87_RS12120 (2511568) | 2511568..2512515 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL87_RS12125 (2512700) | 2512700..2513152 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2513178) | 2513178..2513385 | + | 208 | NuclAT_3 | - | - |
| - (2513215) | 2513215..2513389 | + | 175 | NuclAT_6 | - | - |
| OLL87_RS12130 (2513334) | 2513334..2513435 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| - (2513610) | 2513610..2513819 | + | 210 | NuclAT_4 | - | Antitoxin |
| - (2513644) | 2513644..2513823 | + | 180 | NuclAT_5 | - | - |
| OLL87_RS12135 (2513768) | 2513768..2513869 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| OLL87_RS12140 (2514060) | 2514060..2516330 | - | 2271 | WP_083578756.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OLL87_RS12145 (2516501) | 2516501..2517001 | + | 501 | WP_016634996.1 | cysteine hydrolase family protein | - |
| OLL87_RS12150 (2517400) | 2517400..2518296 | + | 897 | WP_002368434.1 | YitT family protein | - |
| OLL87_RS12155 (2518347) | 2518347..2518745 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Integrative and Conjugative Element | - | EF3023 | 2338899..2588841 | 249942 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T262905 WP_021164441.1 NZ_CP110053:c2513435-2513334 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT262905 NZ_CP110053:2513610-2513819 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|