Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2647152..2647412 | Replicon | chromosome |
Accession | NZ_CP110047 | ||
Organism | Enterococcus faecalis strain BE33 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OLL90_RS12865 | Protein ID | WP_075551663.1 |
Coordinates | 2647311..2647412 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2647152..2647362 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLL90_RS12840 | 2642836..2643789 | - | 954 | WP_264522659.1 | siderophore ABC transporter substrate-binding protein | - |
OLL90_RS12845 | 2643828..2644583 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OLL90_RS12850 | 2644580..2645545 | - | 966 | WP_002365351.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL90_RS12855 | 2645542..2646489 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL90_RS12860 | 2646674..2647126 | + | 453 | WP_002354958.1 | YueI family protein | - |
- | 2647152..2647362 | + | 211 | - | - | Antitoxin |
OLL90_RS12865 | 2647311..2647412 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
OLL90_RS12870 | 2647744..2647845 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
OLL90_RS12875 | 2648034..2650304 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OLL90_RS12880 | 2650475..2650975 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
OLL90_RS12885 | 2651374..2652270 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | tet(M) | - | 2639894..2688820 | 48926 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262859 WP_075551663.1 NZ_CP110047:c2647412-2647311 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT262859 NZ_CP110047:2647152-2647362 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|