Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2665225..2665484 | Replicon | chromosome |
Accession | NZ_CP110041 | ||
Organism | Enterococcus faecalis strain BE43 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OLM01_RS13120 | Protein ID | WP_075551663.1 |
Coordinates | 2665383..2665484 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2665225..2665434 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLM01_RS13090 | 2660478..2661431 | - | 954 | WP_264526425.1 | siderophore ABC transporter substrate-binding protein | - |
OLM01_RS13095 | 2661470..2662225 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OLM01_RS13100 | 2662222..2663187 | - | 966 | WP_174092882.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLM01_RS13105 | 2663184..2664131 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLM01_RS13110 | 2664316..2664768 | + | 453 | WP_002389410.1 | YueI family protein | - |
OLM01_RS13115 | 2664950..2665051 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
- | 2665225..2665434 | + | 210 | - | - | Antitoxin |
OLM01_RS13120 | 2665383..2665484 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
OLM01_RS13125 | 2665674..2667944 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OLM01_RS13130 | 2668115..2668615 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
OLM01_RS13135 | 2669014..2669910 | + | 897 | WP_002389477.1 | YitT family protein | - |
OLM01_RS13140 | 2669961..2670359 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262834 WP_075551663.1 NZ_CP110041:c2665484-2665383 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT262834 NZ_CP110041:2665225-2665434 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|