Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 203422..203679 | Replicon | chromosome |
| Accession | NZ_CP110036 | ||
| Organism | Enterococcus faecalis strain BE52 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OLL99_RS00925 | Protein ID | WP_021164441.1 |
| Coordinates | 203422..203523 (+) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 203472..203679 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OLL99_RS00905 | 198563..199459 | - | 897 | WP_002389477.1 | YitT family protein | - |
| OLL99_RS00910 | 199858..200358 | - | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
| OLL99_RS00915 | 200529..202799 | + | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OLL99_RS00920 | 202989..203090 | + | 102 | WP_075551663.1 | putative holin-like toxin | - |
| OLL99_RS00925 | 203422..203523 | + | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| - | 203472..203679 | - | 208 | - | - | Antitoxin |
| OLL99_RS00930 | 203705..204157 | - | 453 | WP_002389410.1 | YueI family protein | - |
| OLL99_RS00935 | 204343..205290 | + | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL99_RS00940 | 205287..206252 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OLL99_RS00945 | 206249..207004 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OLL99_RS00950 | 207043..207996 | + | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T262801 WP_021164441.1 NZ_CP110036:203422-203523 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 208 bp
>AT262801 NZ_CP110036:c203679-203472 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|