Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 202989..203214 | Replicon | chromosome |
Accession | NZ_CP110036 | ||
Organism | Enterococcus faecalis strain BE52 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | OLL99_RS00920 | Protein ID | WP_075551663.1 |
Coordinates | 202989..203090 (+) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 203035..203214 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLL99_RS00900 | 198114..198512 | + | 399 | WP_002354951.1 | glyoxalase | - |
OLL99_RS00905 | 198563..199459 | - | 897 | WP_002389477.1 | YitT family protein | - |
OLL99_RS00910 | 199858..200358 | - | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
OLL99_RS00915 | 200529..202799 | + | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
OLL99_RS00920 | 202989..203090 | + | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
- | 203035..203214 | - | 180 | - | - | Antitoxin |
OLL99_RS00925 | 203422..203523 | + | 102 | WP_021164441.1 | putative holin-like toxin | - |
OLL99_RS00930 | 203705..204157 | - | 453 | WP_002389410.1 | YueI family protein | - |
OLL99_RS00935 | 204343..205290 | + | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL99_RS00940 | 205287..206252 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
OLL99_RS00945 | 206249..207004 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
OLL99_RS00950 | 207043..207996 | + | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T262795 WP_075551663.1 NZ_CP110036:202989-203090 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT262795 NZ_CP110036:c203214-203035 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|