Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-RNAII/- |
Location | 2494205..2494439 | Replicon | chromosome |
Accession | NZ_CP110020 | ||
Organism | Enterococcus faecalis strain BE69 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | OLM05_RS12035 | Protein ID | WP_002355568.1 |
Coordinates | 2494323..2494439 (-) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | RNAII | ||
Locus tag | - | ||
Coordinates | 2494205..2494340 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLM05_RS12015 (2489695) | 2489695..2490782 | - | 1088 | Protein_2343 | diacylglycerol kinase | - |
OLM05_RS12020 (2490801) | 2490801..2492231 | - | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
OLM05_RS12025 (2492231) | 2492231..2493700 | - | 1470 | WP_002419989.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
OLM05_RS12030 (2493700) | 2493700..2494005 | - | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
- (2494185) | 2494185..2494340 | + | 156 | NuclAT_8 | - | - |
- (2494205) | 2494205..2494340 | + | 136 | NuclAT_10 | - | Antitoxin |
- (2494207) | 2494207..2494412 | + | 206 | NuclAT_4 | - | - |
OLM05_RS12035 (2494323) | 2494323..2494439 | - | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
OLM05_RS12040 (2494587) | 2494587..2496620 | - | 2034 | WP_264516823.1 | NAD-dependent DNA ligase LigA | - |
OLM05_RS12045 (2496746) | 2496746..2499004 | - | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T262777 WP_002355568.1 NZ_CP110020:c2494439-2494323 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 136 bp
>AT262777 NZ_CP110020:2494205-2494340 [Enterococcus faecalis]
TGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTGGTGGCTTACTGAGTTATTGG
TTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
TGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTGGTGGCTTACTGAGTTATTGG
TTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|