Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 384524..384778 | Replicon | chromosome |
Accession | NZ_CP110019 | ||
Organism | Enterococcus faecalis strain BE70 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | OLM00_RS01915 | Protein ID | WP_002355568.1 |
Coordinates | 384524..384640 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 384623..384778 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLM00_RS01905 (379962) | 379962..382220 | + | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
OLM00_RS01910 (382346) | 382346..384376 | + | 2031 | WP_002375948.1 | NAD-dependent DNA ligase LigA | - |
OLM00_RS01915 (384524) | 384524..384640 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- (384551) | 384551..384756 | - | 206 | NuclAT_4 | - | - |
- (384623) | 384623..384758 | - | 136 | NuclAT_10 | - | - |
- (384623) | 384623..384778 | - | 156 | NuclAT_8 | - | Antitoxin |
OLM00_RS01920 (384958) | 384958..385263 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
OLM00_RS01925 (385263) | 385263..386742 | + | 1480 | Protein_353 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
OLM00_RS01930 (386732) | 386732..388161 | + | 1430 | Protein_354 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
OLM00_RS01935 (388180) | 388180..389267 | + | 1088 | Protein_355 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T262766 WP_002355568.1 NZ_CP110019:384524-384640 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 156 bp
>AT262766 NZ_CP110019:c384778-384623 [Enterococcus faecalis]
GAACTATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
GAACTATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|