Detailed information of TA system TA262547

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 210233..210658
• Replicon: plasmid p3
• Accession: NZ_CP109956
• Organism: Escherichia coli strain NC22

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: OI124_RS26160
• Protein ID: WP_223195199.1
• Coordinates: 210536..210658 (+)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	pndB
Locus tag	-
Coordinates	210233..210444 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
OI124_RS26130 (206207)	206207..206704	+	498	WP_050427786.1	single-stranded DNA-binding protein	-
OI124_RS26135 (206767)	206767..207000	+	234	WP_001209608.1	DUF905 domain-containing protein	-
OI124_RS26140 (207059)	207059..209017	+	1959	Protein_214	ParB/RepB/Spo0J family partition protein	-
OI124_RS26145 (209072)	209072..209506	+	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
OI124_RS26150 (209503)	209503..210222	+	720	WP_001276275.1	plasmid SOS inhibition protein A	-
- (210233)	210233..210444	+	212	NuclAT_0	-	Antitoxin
- (210233)	210233..210444	+	212	NuclAT_0	-	Antitoxin
- (210233)	210233..210444	+	212	NuclAT_0	-	Antitoxin
- (210233)	210233..210444	+	212	NuclAT_0	-	Antitoxin
OI124_RS26155 (210478)	210478..210591	+	114	Protein_217	DUF5431 family protein	-
OI124_RS26160 (210536)	210536..210658	+	123	WP_223195199.1	Hok/Gef family protein	Toxin
OI124_RS26165 (210959)	210959..211280	-	322	Protein_219	hypothetical protein	-
OI124_RS26170 (211282)	211282..211568	+	287	Protein_220	hypothetical protein	-
OI124_RS26175 (211687)	211687..212508	+	822	WP_001234485.1	DUF932 domain-containing protein	-
OI124_RS26180 (212804)	212804..213406	-	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
OI124_RS26185 (213728)	213728..214111	+	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
OI124_RS26190 (214301)	214301..214987	+	687	WP_000332490.1	PAS domain-containing protein	-
OI124_RS26195 (215081)	215081..215308	+	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	vat / iroN / iroE / iroD / iroC / iroB / iutA / iucD / iucC / iucB / iucA	1..255823	255823
	-	flank	IS/Tn	-	-	204858..205361	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T262547 WP_223195199.1 NZ_CP109956:210536-210658 [Escherichia coli]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT262547 NZ_CP109956:210233-210444 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin